Method for synthesizing fatty alcohol acetic acid ester in microorganism
A microbial synthesis, alcohol acetate technology, applied in the field of microbial genetic engineering, can solve the problem of high synthesis cost, achieve the effects of fast growth, reduced release, and mature genetic manipulation technology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1 is based on fatty acyl ACP as the precursor molecule to produce fatty alcohol acetate Escherichia coli engineering bacteria (figure 1 shown)
[0025] A) Construction of Fatty Alcohol-Producing Engineering Bacteria
[0026] 1. Using primers AAR-XbaI (GTATCTAGAAAGAGGAGATATAATGTTCGGTCTTATCGGTCATCTC) and AAR-SpeI-BamHI (TGTGGATCCACTAGTTCAAATTGCCAATGCCAAGG) PCR amplification from Synechococcuse longates The AAR gene of bacteria, and then the amplified fragment is wxya with BamHI Insertion into pET28a(+) resulted in vector pDY01. Using primers AHR-XbaI (ATATCTAGAAAGAGGAGATATAATGTCGATGATAAAAAAGCTATGCCG) and AHR-SpeI-BamHI (GTAGGATCCACTAGTTCAAAAATCGGCTTTCAACACCAC) to PCR amplify the AHR gene from Escherichia coli, using wxya with BamHI Insertion into pET28a(+) resulted in vector pDY02. The AAR expression cassette was obtained by double-digesting pDY01 with XbaI and XhoI, and inserted into the vector pDY02 double-digested with SpeI and XhoI to obtain the r...
Embodiment 2
[0031] Embodiment 2 is based on the construction of fatty acid as a precursor molecule to produce fatty alcohol acetate Escherichia coli engineering bacteria ( figure 1 shown)
[0032] A) Construction of Fatty Alcohol-Producing Engineering Bacteria
[0033] 1、 Using primers CAR-XbaI (ATATCTAGAAAGAGGAGATATAATGTCGCCAATCACGCGTGA) and AAR-SpeI-BamHI (AGAGGATCCACTAGTTCAGAGCAGGCCGAGTAGGC) PCR amplification from Mycobacterium marinum The CAR gene of bacteria, and then the amplified fragment was wxya with BamHI Insertion into pET28a(+) resulted in vector pDY06. The 'TesA gene from Escherichia coli was amplified by PCR with primers 'TesA-SacI (AGATGAGCTCATGGCGGACACGTTATTGATTCTGG) and 'TesA-SpeI (TGTACTAGTTTATGAGTCATGATTTACTAAAGGCTGC), and then the amplified fragment was double-digested with SacI and SpeI and inserted into pBBR1MCS1 to obtain vector pDY07. The AHR gene from Escherichia coli was amplified by PCR using primers AHR-BamHI (ACTGGATCCAAGAAGGAGATATAATGTCGATGATAAAAAAGCT...
Embodiment 3
[0038] Example 3 Construction of Escherichia coli Engineering Bacteria Based on Fatty ACP and Fatty Acyl-CoA as Precursor Molecules to Produce Fatty Alcohol Acetate ( figure 1 shown)
[0039] A) Construction of Fatty Alcohol-Producing Engineering Bacteria
[0040] 1、 Using primers FAR-XbaI (CAATCTAGAAAGAGGAGATATAATGGCAATACAGCAGGTACATCAC) and FAR-SpeI-BamHI (CGAGGATCCACTAGTTCAGGCAGCTTTTTTGCGCT) PCR amplification from M. aquaolei Bacteria's FAR gene, and then the amplified fragment was wxya with BamHI Insertion into pET28a(+) resulted in vector pDY11.
[0041] 2. The recombinant vector pDY11 was introduced into Escherichia coli GM1655 to obtain GDY5 engineering bacteria. The engineering bacterium realizes the high expression of the FAR gene. The FAR enzyme was expressed to catalyze the direct reduction of fatty acid synthesis intermediates acyl-ACP and acyl-CoA to fatty alcohols.
[0042] B) Construction of Fatty Alcohol Acetate Engineering Bacteria
[0043] 1、 The v...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
