Molecular identification method used for Paeonia rockii and Paeonia cathayana
A technology for molecular identification of peony, applied in the field of molecular biology, can solve problems such as identification difficulties, intellectual property protection and identification difficulties of peony varieties, and achieve the effect of avoiding errors
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment
[0021] Using 4 wild species of Paeonia purpurea from different regions in Gansu, 42 cultivars of Paeonia purpurea and 11 germplasms of peony from the Central Plains in Luoyang as test materials, DNA extraction kits from TIANGEN Company were used to extract DNA from the samples, and the forward primers used were: CCTATATCCGCTACTCCTTC, reverse primer CTCAGTGAATTTCACCACG, PCR amplification conditions were pre-denaturation at 95°C for 5 minutes, followed by 30 seconds at 95°C, annealing at 48°C for 45 seconds, and extension at 72°C for 30 seconds. A total of 35 cycles were performed, and finally extended at 72°C for 7 minutes. After sequencing and comparing, there are 2 fixed difference sites identified at 31bp (base T) and 79bp (base C) for P. peony and Central Plains.
[0022] Such as figure 1 , figure 2 , image 3 as shown, figure 1 , figure 2 Among them, 1-20 represent the cultivars of P. peony, 21-24 represent the cultivars of P. peony in Central Plains, and S is the ma...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



