Hyphantria cunea Iap gene dsRNA, and bacterial expression liquid and application thereof
A kind of American white moth, bacteria technology, applied in the direction of DNA / RNA fragment, application, genetic engineering, etc., to achieve the effect of good effectiveness and sensitivity, convenient operation and strong implementability
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1, American white moth Iap gene full-length clone
[0025] (1) The larvae of H. americanum were collected, and the total RNA of H. americanum was extracted by TRIzol method (Trizol Plus reagent, Ambion, Austin, TX, USA).
[0026](2) Use the reverse transcription kit GoScriptTM Reverse Transcription System kit (Promega, Madison, WI, USA) to synthesize the first strand of cDNA. The reverse transcription system is: total RNA 1 μg, Oligo(dT) 15 Primer (500μg / ml) 0.5μL, GoScriptTM 5X Reaction Buffer 4μL, MgCl 2 (25mM) 1μL, Random Primers (500μg / ml) 0.5μL, PCR Nucleotide Mix 1μL, Recombinant Ribonuclease Inhibitor 0.4μL, GoScriptTM Reverse Transcriptase 1μL, Nuclease-Free Water make up 20μL. The reaction conditions are 42°C, 15min, 70°C, 15min.
[0027] (3) Design primers on both sides of the coding region sequence of the gene according to the transcriptome sequence of the larvae of the white moth. Primers were designed using Primer5 software to obtain forward...
Embodiment 2
[0033] Embodiment 2, the synthesis of American white moth Iap gene dsRNA
[0034] (1) The correct plasmid (plasmid having the sequence of SEQ ID NO.1) was verified by the sequencing result to continue PCR amplification with the dsRNA primers having the T7 promoter sequence, and the amplification method and system refer to the steps of the above-mentioned Example 1 ( 3). The amplified product is recovered and purified, and the recovery and purification method refers to the step (4) of the above-mentioned Example 1.
[0035] The PCR amplification primers are:
[0036] F: taatacgactcactataggGTTTTTATTGTGACGGTGGC (number in the sequence listing: SEQ ID NO.5)
[0037] R: taatacgactcactataggGTGTTTCTTCGTTAGGGGTT (number in the sequence listing: SEQ ID NO.6)
[0038] (2) The PCR amplification product obtained in the above step (1) is purified and recovered to serve as a template for dsRNA in vitro transcription.
[0039] dsRNA was synthesized in vitro using T7 RiboMAXTM Express RNA...
Embodiment 3
[0043] Embodiment 3, the preparation of expressing white moth Iap gene dsRNA bacterial expression bacterial liquid
[0044] (1) Select two restriction sites on the L4440 plasmid (Addgene Company), which are Bgl II (AGATCT) and PstI (CTGCAG), respectively, and use the cDNA of the white moth as a template, with corresponding restriction sites and protection Base dsHcIap primers are used for PCR amplification, and the amplification method and system refer to the step (3) of the above-mentioned Example 1. The amplified product is recovered and purified, and the recovery and purification method refers to the step (4) of the above-mentioned Example 1.
[0045] The dsHcIap primer is:
[0046] F: GAAGATCTTCGTTTTTATTGTGACGGTGGC (number in the sequence listing: SEQ ID NO.7)
[0047] R: AACTGCAGAACCAATGCATTGGTGTTTCTTCGTTAGGGGTT sequence (number in the list: SEQ ID NO.8)
[0048] (2) Use BglII and PstI (Takara) to linearize the L4440 vector according to the sequences of the two restric...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


