Nucleic acid reagent and digital PCR kit for detecting providencia
A Providence bacterium and kit technology are applied in the field of nucleic acid reagents and digital PCR kits for the detection of Providence bacterium, and can solve the problem that Providence bacterium has not yet been developed.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Detection method and detection result determination
[0042] 1. Primer and probe synthesis
[0043] Sequence synthesis was performed according to the primer sequences shown in Table 1 and the probe sequences shown in Table 2. In the probe, FAM, VIC, CY5 and A425 are fluorescent groups; MGB and BHQ1 are quenching groups.
[0044] Table 1
[0045]
[0046] Table 2
[0047] serial number probe code sequence retouch Detection target 9 LSP CACATGCAGATTTC FAM-MGB Providencia reye 10 SSP CAAACCACATGCTGAC VIC-MGB Providencia stutzeri 11 CJP AACCTCATGCGGATTT CY5-MGB Providencia alcaligenes 12 IC-P CGCGACGGATCTACGTCACAGCG A425-BHQ1 External internal control
[0048] The nucleotide sequences of SEQ ID NO. 13-15 are shown below:
[0049] >P.rettgeri (Providence reckii)
[0050] ATGAAAGCACTGACGGCTCGACAACAGCAGGTTTACGATCTAGTGCGTGACCACATTTCGCAGACGGGTATGCCTCCTACACGCGCTGAGATAGCAGCAAGCCTTGGTTTTCGTTCGCCT...
Embodiment 2
[0074] Example 2 Specificity and Sensitivity Assays
[0075] Providencia reye, Providencia stutzeri, Providencia alcaligenes, Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, Staphylococcus aureus, feces Enterococcus, Enterococcus faecalis and Streptococcus pneumoniae were obtained from purchased inactivated bacteria.
[0076] The Providencia-specific primer pairs and probes designed in Example 1 were evaluated and validated. The reaction system was the same as in Example 1, and digital PCR amplification was performed. FAM, VIC, CY5 and A425 were selected as reporter groups, and the reaction procedure was the same as that of Example 1.
[0077] Judgment of PCR amplification results: blank control and negative control established;
[0078] The results are shown in Table 4. The DNA of Providencia reinhardtii was detected, and there were detected values in the FAM channel and the internal control A425 channel, indicating the nucleotid...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



