134 results about "Iridovirus" patented technology

The invention discloses a fast detection method for grouper iridovirus, firstly proposing a loop-mediated isothermal nucleic acid amplifying detection applied for the detection of grouper iridovirus, which comprises the steps as follows: (1)a ORF-014L is cloned and a recombinant plasmid template containing ORF-014L is constructed; (2)primer design, primer sequence; (3)amplification, the reaction temperature is 63-65 DEG C, and the reaction time 20-60mins. The LAMP detection technique of the invention can rapidly detect SGIV, the transcriptional expression of SGV 014L in cells, the grouper tissue infected by SGIV, and the GP cells infected by SGIV; the sensitivity of the invention is three orders of magnitude higher than Nested PCR, reaching to six point six copies.

The invention discloses an antiviral complex traditional Chinese medicine and a preparation method and application of the antiviral complex traditional Chinese medicine. The complex traditional Chinese medicine comprises isatis root, rheum officinale, astragalus mongholicus, folium isatidis, houttuynia cordata and polygonum cuspidatum. The antiviral complex traditional Chinese medicine and the preparation method provided by the invention are reasonable in prescription, and simple in preparation technology; as the clinical test shown, the traditional complex traditional Chinese medicine can be applied to preparing medicine for treating or preventing white spot syndrome of cray, hemorragic disease of grass carp, haematopoietic necrosis of crucian, koi herpes virus disease, channel catfish virus disease, iridovirus disease of siniperca chuatsi, and virosis of aquatic livestock; and the antiviral complex traditional Chinese medicine has high efficiency, is safe and has no toxic and side effect, and has a wide clinical application prospect.

The invention discloses a double-PCR (polymerase chain reaction) method for detecting iridovirus of micropterus salmoides. By the double-PCR method, two kinds of iridoviruses belonging to ranavirus and tumefaction cell viruses can be simultaneously detected and identified by the aid of two pairs of specific primers and optimized reaction system and reaction conditions. The double-PCR method is high in sensitivity and specificity and capable of quickly and accurately diagnosing iridovirus of micropterus salmoides and identifying species.

According to epidemic disease and electrical mirror morphological analysis to ill fish, the cause of disease is iris virus. Definite the iris virus ATPase gene conservative area sequence as augmentation target sequence, and design and synthesize double specificity primers and a molecule beacon probe to quantitative detect fish iris virus. According to the quantitative calibration curve made by different concentration gradient positive plasmid, the logarithm of different gradient quantitative mold number is correlation with Ct, and the correlation coefficient is 0.998; at the same time, the detection method has high sensibility, and it can detect at least 70 virus particles. Detecting other virus and LYCIV genes express that the method has good specificity.

The invention discloses a DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as a screening method and an application of the DNA aptamer. Two inverse screening steps are introduced in each screening process; first, a single-stranded DNA library of the former screening process is bound with normal cells to remove nonspecific ssDNA (single-stranded DNA) bound with the normal cells of a grouper; then, supernatant is bound with grouper iridovirus infected cells for screening; and ssDNA separated from the grouper iridovirus infected cells is bound with the normal cells for separation to obtain the supernatant. A PCR (Polymerase Chain Reaction) amplification library prepares the single-stranded DNA library. The above screening flow is repeated; compared with the number of the normal cells in the first screening process, the number of the normal cells in the screening process is increased by 2-6 times; compared with binding time of the library and the cells in the first screening process, the binding time of the library and the cells in the subsequent screening process is increased to 1h from 0.5h; and the binding time of the library and the virus infected cells is shortened to 0.5h from 1h to improve the screening efficiency of each process.

The invention belongs to the technical field of biological medicines for veterinary use and in particular relates to a largemouth bass iridovirus disease inactivated vaccine and a preparation method thereof. The vaccine comprises EPC (epithelioma papulosum cyprinid) cells and largemouth bass ranavirus LMBV. The preparation method comprises the following steps: culturing EPC cells; performing LMBVvirus amplification on the cultured EPC cells so as to obtain an LMBV virus liquid; and performing inactivation treatment on the LMBV virus liquid. The vaccine prepared by the invention is good in immune protection effect and can be applied to prophylactic immunization of largemouth bass iridovirus, and the survival rate and the breeding benefits of largemouth bass can be increased.

The invention discloses a DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as a screening method and an application of the DNA aptamer. Two inverse screening steps are introduced in each screening process; first, a single-stranded DNA library of the former screening process is bound with normal cells to remove nonspecific ssDNA (single-stranded DNA) bound with the normal cells of a grouper; then, supernatant is bound with grouper iridovirus infected cells for screening; and ssDNA separated from the grouper iridovirus infected cells is bound with the normal cells for separation to obtain the supernatant. A PCR (Polymerase Chain Reaction) amplification library prepares the single-stranded DNA library. The above screening flow is repeated; compared with the number of the normal cells in the first screening process, the number of the normal cells in the screening process is increased by 2-6 times; compared with binding time of the library and the cells in the first screening process, the binding time of the library and the cells in the subsequent screening process is increased to 1h from 0.5h; and the binding time of the library and the virus infected cells is shortened to 0.5h from 1h to improve the screening efficiency of each process.

The invention discloses a DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as a screening method and an application of the DNA aptamer. Two inverse screening steps are introduced in each screening process; first, a single-stranded DNA library of the former screening process is bound with normal cells to remove nonspecific ssDNA (single-stranded DNA) bound with the normal cells of a grouper; then, supernatant is bound with grouper iridovirus infected cells for screening; and ssDNA separated from the grouper iridovirus infected cells is bound with the normal cells for separation to obtain the supernatant. A PCR (Polymerase Chain Reaction) amplification library prepares the single-stranded DNA library. The above screening flow is repeated; compared with the number of the normal cells in the first screening process, the number of the normal cells in the screening process is increased by 2-6 times; compared with binding time of the library and the cells in the first screening process, the binding time of the library and the cells in the subsequent screening process is increased to 1h from 0.5h; and the binding time of the library and the virus infected cells is shortened to 0.5h from 1h to improve the screening efficiency of each process.

The invention provides a detection kit for red sea bream iridovirus, comprising a specific primer group which is designed for detecting the red sea bream iridovirus. The specific primer group is composed of the following 6 specific primers: a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP), a backward inner primer (BIP), a loop forward primer (LF) and a loop backward primer (LB). The kit provided by the invention adopts the loop-mediated isothermal amplification (LAMP) technology and designs 6 primers based on the full gene sequence of the main capsid protein (MCP) of the red sea bream iridovirus, so that the target fragment is subjected to circulatory displacement and amplification in an isothermal environment, the amplification of a target sequence is realized, and further, the detection purpose is achieved. The kit for detecting the red sea bream iridovirus is rapid and efficient, can meet the onsite and timely detection requirements and provides technical support for the quick detection of the red sea bream iridovirus in aquaculture industry of Chinese and international fish trade.

The invention dislcoses an RAA (recombinase-aid amplification) constant-temperature fluorescence detection method and a detection kit for SIV (shrimp iridovirus). The detection kit comprises a forwardprimer SEQ ID NO. 1, a reverse primer SEQ ID NO. 2, a specific fluorescence probe SEQ ID NO. 3, reaction liquid, recombinant polymerase and a reference substance. The kit has the advantages that thespecificity is strong; the detection sensitivity is high, and can reach 2fg / mu L; high accuracy and reliability are achieved; the operation is simple and rapid, and the kit is suitable for field detection and has wide application scenarios.

The invention belongs to the technical field of detection of red-sea bream iridovirus infection, and relates to a real-time quantitative detection method of polymerase chain reaction (PCR) technology by adopting a fluorescent probe or an SYBR GREEN I fluorescent dye, in particular to a real-time quantitative PCR detection method for red-sea bream iridovirus. The method comprises the following steps of: designing a specific primer sequence and a fluorescent probe sequence, then establishing a real-time quantitative PCR system and a reaction program, preparing plasmids containing a target amplification fragment as a standard substance to draw a standard curve, and finally establishing a result judgment base of a sample to be detected. The method has the advantages of simple detection, high detection speed, good effect, accurate quantification, strong specificity, high sensitivity and the like.

The invention discloses a spinner bottle production method of inactivated singapore grouper iridovirus (SGIV) vaccine. The production method comprises spinner bottle culture of cells, amplification and harvest of viruses and inactivation of the viruses. By using the spinner bottle production method of the inactivated SGIV vaccine disclosed by the invention, the inactivated SGIV vaccine can be produced on a large scale, and the production cost is low and the labor intensity is small since the production is industrial streamline production; after vaccine inspection on the produced inactivated SGIV vaccine, the inactivated SGIV vaccine is safe from the aspect of cell level and fish level; vaccine efficacy detection proves that the relative protection rate of the inactivated SGIV vaccine provided by the invention is 87.0-95.7%, so that inactivated SGIV vaccine provides obvious protection for immune grouper, the immune protection efficacy is good and quality between batches is stable.

The invention discloses an aptamer-based enzyme-linked immunosorbent assay method for detecting iridovirus infection of groupers. The method comprises the following steps: incubating and combining a biotin-labeled aptamer and to-be-detected cells or tissues; cleaning a to-be-detected sample, adding horse radish peroxidase-labeled streptavidin, cleaning the to-be-detected sample after incubation completion, adding a TMB developing solution in a horse radish peroxidase developing kit for carrying out a developing reaction, and determining whether the to-be-detected cell or tissue sample is infected by grouper iridovirus according to light absorption value change. Compared with the existing antibody-based ELISA technology, the aptamer-based ELISA technology disclosed by the invention has the advantages that the method is high in specificity and sensitivity and convenient to operate, is suitable for large-scale rapid detection of iridovirus infection of cultured fishes in aquaculture farms and has good application prospects in the detection field of iridovirus infection.

The invention relates to a preparation method of an inactivated vaccine for the iridovirus of a grouper, comprising the following steps of: inoculating the iridovirus to embryonic cells of the grouper in a logarithmic phase by taking an embryonic fine system of the grouper as an amplification system of the iridovirus; repeatedly freezing and thawing and centrifugalizing after complete lesion, and inactivating an obtained iridovirus solution at 4 DEG C for 16 hours by using beta-propiolactone with the final concentration of 1:500 so as to obtain the inactivated iridovirus vaccine. The inactivated iridovirus vaccine is applied to a juvenile immunized Malabar grouper, and an iridovirus counteracting result shows that relative protection ratio is more than 90 percent after 15 days. The preparation method has the advantages of easiness and convenience for operation, simple equipment requirement and good repeatability and keeps good immunogenicity of the iridovirus under the precondition of efficiently inactivating the iridovirus, thereby having good immune protection effect; in addition, the invention can be used for the preventive immune of the grouper, thereby enhancing the survival rate and the culturing efficiency of cultured groupers.

The invention discloses a hyper-branched rolling cycle amplification detection method of soft-shelled turtle iridovirus, and the method is characterized by comprising the following steps: (1) designing a padlock probe and a pair of universal primers aiming at the connection sequence of the padlock probe; (2) preparing a padlock probe connection reaction system for performing connection reaction; and (3) preparing an HRCA (hyper-branched rolling cycle amplification) reaction system for performing HRCA amplification reaction, and finally detecting HRCA reaction products. The method has the following advantages: the method has higher sensitivity, specificity and convenience compared with the PCR (polymerase chain reaction) detection method of the soft-shelled turtle iridovirus in the prior art; furthermore, the method is simple and easy to operate, the detection method is fast and efficient, and 2-4 hours can be saved in comparison with the conventional PCR detection.

The present invention relates to a method for screening protective antigens of grouper iridescent virus (SGIV), specifically the identification of protective antigen genes from grouper iridescent virus with vaccine development prospects, including bioinformatics analysis and DNA vaccine identification. Protective antigens were screened out by challenge after preparation and immunization. The present invention provides three protective antigen genes screened out from SGIV162 virus-encoded genes, and provides a method for analyzing and screening potential vaccine candidate antigens in virus-encoded genes, which is beneficial to the further development of new grouper iridescent The virus vaccine can effectively prevent and control grouper iridescent virus disease, and improve the survival rate and breeding efficiency of grouper.

The invention relates to the technical field of aquatic product culture, in particular to a method for inhibiting iridovirus proliferation in a micropterus salmoides culture process of an RAS system.The method comprises the step of adding citrus flavone extract and black Chinese wolfberry anthocyanin extract into the RAS system. According to the method, the citrus flavone extract and the black Chinese wolfberry anthocyanin extract have a synergistic effect, so that the proliferation of iridovirus is inhibited, and the technical problem that the iridovirus in an RAS culture system causes fishto die due to illness is solved. By implementing the scheme, cultured fishes can be prevented from being infected by iridovirus, the survival rate of aquatic products is increased, the quality of theaquatic products is improved, and economic losses are reduced.

The invention discloses giant salamander iridescent virus vaccine, a preparation method and an application. The giant salamander iridescent virus vaccine is recombinant protein translated after truncating and optimizing a major capsid protein gene of a giant salamander iridescent virus, and has a sequence as shown as SEQIDNO.2 (Sequence Identifier Number 2). A nucleotide sequence corresponding to the protein is optimized according to preference of a yeast codon to synthesize a gene segment which is transferred to a yeast expression vector, and pichiapastoris Km71 / GSIV-MCP (i) Pichiapastoris(1 / i)Km71 / GSIV-MCP (CCTCC (China Center for Type Culture Collection) NO: M2014573) of the high expression recombinant protein is finally obtained via high copy and clone screening. The protein produced by fermentating the yeast has the characteristics of high activity and large yield. An immunoprotection experiment determines that the antigen protein can effectively prevent a giant salamander iridescent virus disease.

The invention discloses a loop-mediated isothermal amplification (LAMP) detection method and a kit of soft-shelled turtle iridovirus (STIV). An outer primer comprises sequences shown as Seq ID No.1 and Seq ID No.2. A quick, sensitive and specific detection method for detecting the STIV is provided, field instant detection of viruses can be performed, and technical support is provided for healthy cultivation of soft-shelled turtles and the development of international trade.

The invention relates to the technical field of immunodetection, and particularly relates to an ELISA kit for detecting a largemouth bass ranavirus antibody and a detection method thereof. The kit comprises an antibody trapping agent, a solid-phase support, a first antibody, an enzyme-labeled second antibody, confining liquid, developing liquid and stop buffer, wherein the antibody trapping agent is recombinant largemouth bass ranavirus LVMCPn protein, and the amino acid sequence of the antibody trapping agent is shown as SEQ ID NO: 1. The kit has good sensitivity and specificity to an LMBV antibody and has good repeatability and stability.

The invention discloses a primer set, kit and method for performing isothermal detection on CRISPR-Cas12a protease of prawn iridescent viruses. The primer set includes a pair of RPA primers, crRNA anda molecular probe including fluorescent groups and quenching groups, and nucleotide sequences are shown as SEQ ID NO. 1-4. The provided primer set and kit for performing isothermal detection on CRISPR-Cas12a protease of prawn iridescent viruses can specifically identify the specific sequence of a prawn iridescent virus CMP gene, so that extremely high specificity and sensitivity can be achieved,the minimum detection limit can reach 0.1 ag / [mu]L; the primer set and kit are very stable and can effectively avoid false positive results generated by non-specific amplification; and the primer setand kit are suitable for the early monitoring on the inapparent infection of the prawn iridescent viruses.

The invention provides a polymerase chain reaction PCR detection method of a largemouth black bass ulcer syndrome virus, comprising the following steps of: comparing the MPC (Main Capsid Protein) gene sequence of the largemouth black bass ulcer virus with the MPC gene sequence of an unknown iridovirus, and designing and synthetizing the following primers: P1: 5'-TCTGTTACGGGTTCTGGCATC-3' and P2: 5'-CCAGCCAAGAGTTGAGCACAT-3'; amplifying a segment 241bp; and carrying out template DNA (deoxyribonucleic acid) extraction, PCR reaction and agarose gel electrophoresis detection, and detecting that the lowest density of plasmids is 10[4] copy number / muL after the PCR reaction is carried out for 30 rounds. The method has the technical characteristics of rapid detection, high precision and low cost and is suitable for being popularized and applied in a wide range.

The invention discloses a preparation method of an iridovirus cell inactivated vaccine for Chinese giant salamanders, and an application method thereof. The vaccine is prepared by the following method: 1, sterilely acquiring the liver of a moribund giant salamander containing frog iridovirus, preparing a tissue homogenate; 2, quickly cracking the tissue homogenate by ultrasonic wave of 20kHz on an ice surface, filtering; 3, centrifugally separating the filtrate to obtain pure virus precipitate, then regulating the virus titer to 105TCID50; 4, culturing the virus cells, collecting a cell culture solution; and 5, and inactivating the cell culture solution by formaldehyde with the final concentration of 0.4% at 37 DEG C for 5-10 hours, thus obtaining the iridovirus cell inactivated vaccine for Chinese giant salamanders. The vaccine is effective when preserved at 4 DEG C within one year. For young giant salamanders and adult giant salamanders below 0.25kg in body weight, dipping bath with the dilute solution of the vaccine is adopted for immunization, and for adult giant salamanders above 0.25kg in body weight, intramuscular injection is adopted for immunization. The vaccine has very strong immunologic specificity, and the immunization rate can reach 80-93%.

The invention discloses a colloidal gold visual detection method for Micropterus salmoides Ranavirus iridovirus and a probe for the method; the method comprises: incubating the probe with colloidal gold to obtain AuNPs-probe; extracting virus DNA in Micropterus salmoides to be detected; mixing the virus DNA with AuNPs-probe, culturing at 37 DEG C, and adding NaCl solution; observing the color change of the mixed solution 2 minutes later; if the color of the mixed solution is still red, determining that the result is negative, and if the color of the mixed solution is gray blue, determining that the result of the sample is positive. The method is simple, low in cost, high in speed and reliable, and is more suitable for on-site detection. The invention provides the effective method for rapiddetection of Micropterus salmoides iridovirus and provides technical guarantee for aquaculture.

The invention discloses a primer group for detecting prawn iridovirus and a kit containing the primer group, and belongs to the technical field of aquatic pathogenic organism detection reagents. The primer group for detecting the prawn iridovirus is designed according to a nucleic acid sequence shown in SEQ ID No: 1. The primer group disclosed by the invention is high in sensitivity and good in specificity; the primer group for detecting the prawn iridovirus solves the problems of dependence on large expensive instruments and complex detection operation in the prior art; and moreover, the primer group is suitable for rapid determination of simple and crude conditions such as aquaculture farms.

The invention discloses a monoclonal antibody with rock bream iridovirus ORF049L recombinant proteins. The monoclonal antibody is produced by secreting rock bream iridovirus ORF049L recombinant protein hybridoma of which the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.7304. A preparation method of the monoclonal antibody comprises the following steps of: obtaining the rock bream iridovirus ORF049L recombinant proteins with the molecular weight of 16.9 kDa through gene cloning and prokaryotic expression; taking the obtained recombinant proteins as antigens to immune mice; performing cell fusion on mice spleens and myeloma cells, and screening and secreting the hybridoma of the rock bream iridovirus ORF049L recombinant protein monoclonal antibody by an immunoblotting method, a dot immunobinding assay and an indirect immunofluorescence; and cloning positive hybridoma by a finite dilution method.

The invention provides primers and a probe for detecting the fragment S of a rift valley fever virus, wherein, a forward primer is 5'-GGATTACTTTCCTGTGATATCTGTTG-3'; a reverse primer is 5'-GTATCCTGGGAGGRCCATCWC-3', R refers to A or G and w refers to T or A); and a probe is 5'-F1-ACTCCACTGACACAACACGACGACCACT-Q1-3', F1 is a fluorescent reporter and Q1 is a fluorescent quencher. The invention also provides a real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) detection method for the fragment S of the rift valley fever virus. In the method, pseudovirus grains of the rift valley fever virus are taken as a template, and the primers and the probe are used to carry out real-time fluorescent RT-PCR, thus judging whether the detected virus is the rift valley fever virus according to the detected result. The probe provided by the invention has high sensitivity and good specificity, and has no cross reaction with all of Africa swine fever virus, irides virus and goatpox virus.

The invention relates to an extraction method for envelope protein of grouper iridovirus. According to the method, virus particles are purified by sucrose density gradient centrifugation; purified viruses are treated by 1% sodium dodecyl sulfonate (SDS); and virus envelope proteins are separated. The invention is mainly directed at virus envelope proteins, is favorable for promoting development of research on virus envelope proteomics and for further research on functions of grouper iridovirus envelope proteins in the process of virus infecting of hosts and for understanding of the interacting mechanism between viruses and hosts at molecular and cellular level, and provides a convincing scientific basis and application basis for controlling iridovirus diseases and developing viral vaccines.

The invention discloses a shrimp health system visual rapid detection kit based on an LAMP technology, and belongs to the technical field of aquatic pathogen detection reagent development. The kit comprises an internal reference quality control primer group and a to-be-detected pathogen primer group. The kit is designed for common shrimp pathogenic microorganisms of IHHNV virus, white spot syndrome virus, enterocytozoon hepatopenaei, shrimp hemocyte iridescent virus, shrimp acute hepatopancreatic necrosis disease-vibrio parahaemolyticus and the like; the kit can be used for simultaneously detecting various pathogens; by adding the internal reference quality control primer group, the influence of failure of a reaction reagent and nucleic acid extraction quality of an amplification templateon a detection result can be eliminated; the accuracy of the detection result is ensured; and the kit is suitable for screening and purchasing young shrimps and parent shrimps by grass-roots farmers and customs rapid quarantine customs clearance.

The invention relates to a nucleic acid aptamer for identifying grouper iridovirus infected cells. The nucleic acid aptamer has the following nucleotide sequences: TGAAGTTCAGGTTACTGCGCGCGCGTCTATTGCATGTCGGCCGAGCTGGT. The aptamer provided by the invention is small in molecular weight, short in preparation period, good in reproducibility, convenient for in-vitro chemical synthesis and marking, stablein sequence and easy to transport and store. The nucleic acid aptamer has high specificity and affinity to grouper iridovirus, and has no immunogenicity.