Winter squash EF1-alpha gene and application thereof
An Indian pumpkin, alpha gene technology, applied in the field of molecular biology, can solve problems such as unreported, and achieve the effects of improving detection efficiency, strong specificity, and improving reliability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 Obtaining of internal reference genes
[0020] According to the results of Illumina high-throughput deep sequencing of Indian pumpkin fruit transcriptome by our research group, the full-length cDNA of EF1-α gene was screened. After PCR amplification and sequencing verification, the full-length cDNA of the gene was 1701 bp, and the size of the open reading frame was 1344bp, the sequence is as follows:
[0021] GGGCTGCTTGCTACTGCGTAAAATTGAGGCTGCTTCTTTCTTCTCATTTCTCTGCAAATTCTTGTGGGCTCATTTGGTTAATATCAA ATG GGTAAGGAAAAGATTCATATTAACATCGTGGTTATTGGCCATGTCGACTCTGGAAAGTCGACCACCACCGGTCATCTTATCTACAAGCTTGGTGGAATTGACAAGCGTGTGATCGAGAGATTCGAGAAGGAAGCTGCTGAGATGAACAAAAGGTCATTCAAGTATGCTTGGGTGCTCGACAAACTTAAGGCAGAGCGTGAACGTGGTATTACCATTGACATTGCTCTGTGGAAGTTTGAGACCACCAAGTACTACTGCACAGTCATCGATGCCCCCGGACATCGTGACTTTATCAAGAACATGATTACTGGAACCTCTCAGGCTGATTGTGCCGTCCTCATCATTGACTCGACCACTGGTGGTTTTGAAGCTGGTATTTCCAAGGATGGTCAAACCCGTGAGCACGCTCTCCTTGCTTTCACCCTTGGTGTCAAGCAAATGATCTGCTGCTGTAACAAGATGGATGCC...
Embodiment 2
[0022] Example 2 Real-time fluorescent quantitative PCR design and routine PCR detection
[0023]Based on the nucleotide sequence of the Indian pumpkin internal reference gene EF1-α obtained in Example 1, and following the principle of real-time fluorescent quantitative PCR primer design, a pair of fluorescent quantitative specific primers were designed, and the amplified fragment was 211 bp. The fluorescent quantitative specific primers are the real-time fluorescent quantitative PCR primers (as shown in SEQ ID NOs: 2 and 3): forward primer 5'-ACGGTGATGCTGGTATGGTTA-3', reverse primer 5'-CATTGTTGTTGGTTGGCTTATT-3'.
[0024] Extract the total RNA of Indian pumpkin, and synthesize the first strand of cDNA according to the method of PrimeScriptTM 1st Strand cDNA Synthesis Kit, that is, reverse transcribe the RNA into cDNA; then use the obtained cDNA as a template and real-time fluorescent quantitative PCR primers as primer pairs for PCR Amplification, and the reaction system and re...
Embodiment 3
[0028] Example 3 Real-time fluorescent quantitative PCR primer verification
[0029] Total RNA was extracted from Indian squash, and the first strand of cDNA was synthesized according to the method of PrimeScriptTM 1st Strand cDNA Synthesis Kit, that is, the RNA was reverse transcribed into cDNA; then the obtained cDNA was used as a template, followed by Power SYBR® Green PCR Master Mix instructions in ABI7500 The PCR reaction was carried out on the real-time quantitative PCR instrument, and the reaction system and reaction procedure of the PCR reaction were as follows:
[0030] The reaction system is: the total volume of the reaction system is 25 μL, 12.5 μL Power SYBR® Green PCR MasterMix, 1 μL template, 0.5 μL of the forward primer of the real-time fluorescence quantitative PCR primer in Example 2 (concentration is 10 μmol / L), implement The reverse primer of the real-time fluorescent quantitative PCR primer in Example 2 was 0.5 μL (concentration: 10 μmol / L), and distilled w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



