Gene with triglyceride (TAG) synthesis function and construction method and application thereof
A triglyceride, gene technology, applied in microorganism-based methods, applications, genetic engineering, etc., can solve the problems of high cost, inability to meet, poor versatility, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Cloning and Analysis of NoDGAT2 Gene
[0043] The NoDGAT2J and 2K genes and their flanking sequences were respectively cloned from the gDNA and cDNA of Nannochloropsis IMET1 by PCR technology, and the primers used were designed according to the data recorded in the literature of Li et al, 2014, and the required enzymes were introduced at both ends of the primers The cut site was handed over to Shanghai Sangong for synthesis:
[0044] 1) NoDGAT2J-for:
[0045] 5'GGTACCACATAATGGCTCACCTCTT 3';
[0046] 2) NoDGAT2J-rev:
[0047] 5'GAATTCTCAAGAGATCGCAACGAAC3';
[0048] 3) NoDGAT2K-for:
[0049] 5'AAGCTTACATAATGTTGCTGGCGTCGT 3';
[0050] 4) NoDGAT2K-rev:
[0051] 5'GAATTCTCAGACGATGCGAAGCGTC 3';
[0052] The PCR machine used was MasterCycler from Eppendorf Company, the reaction system was 50 μL, including 4 μL dNTP (2.5 mM each, TAKARA), 2 μL each of forward and reverse primers (10 μM), 5 μL 10×buffer (Mg2 + plus, TAKARA), 0.4 μL rTaq enzyme (5U / μL, TAKARA),...
Embodiment 2
[0055] Example 2: Overexpression of NoDGAT2 in Nannochloropsis marine IMET1
[0056] (1) Construction of endogenous overexpression vector
[0057] see figure 2 . The specific method of constructing the vector is as follows: by PCR method (the same as the PCR conditions of Example 1), with the pMD18-T vector of NoDGAT2J or 2K as a template, according to the following two sets of primers, i.e. one group is 1) and 2), The other group is 3) and 4) respectively amplified to obtain the full-length ORF fragments of NoDGAT2J or 2K. In order to construct the cloning, with the help of the primer introduction method, a restriction site and a protective base are added to the 5' end of the target sequence, and a restriction site is added to its 3' end. The primer sequence is as follows:
[0058] 1) NoDGAT2J-oe-for:
[0059] 5' CCGCTCGAGATGGCTCACCTCTTC 3';
[0060] 2) NoDGAT2J-oe-rev:
[0061] 5'GGGGAATTCTCAAGAGATCGCAACG 3';
[0062] 3) NoDGAT2K-oe-for:
[0063] 5' CCGCTCGAGATGTTGC...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



