56 results about "Puccinia striiformis" patented technology

The invention relates to a single tube nested PCR (polymerase chain reaction) detection method for wheat stripe rust bacteria and a primer thereof. The method comprises the following steps: in a single PCR reaction tube, finishing the nested PCR amplification once by an inner pair and an outer pair of wheat stripe rust bacteria specific primers; and judging that wheats or unknown pathogen spores to be detected are wheats infected by the wheat stripe rust bacteria or the wheat stripe rust bacteria by a target segment, wherein the sequences of the nucleotide residues of the inner pair and the outer pair of wheat stripe rust bacteria specific primers are disclosed in SEQ ID No.1, 2, 3 and 4. The method disclosed by the invention has good specificity, is simple and easy to realize, and can beused for early detection for field wheat stripe rust and used for monitoring diseases, and the detection sensitivity is 20fg.

The invention discloses N-(2-acet)salicyloyl hydrazone-rare earth complex shown by a general structural formula (I) and a preparation method and use thereof. In the general structural formula, RE may be Pr, Nd, Eu, Dy, Yb, Er or Y; and nH2O is the crystallization water in the complex and n is between 0 and 5. The preparation of the rare earth complex comprises: heating methyl salicylate and hydrazine hydrate in a molar ratio of 1:1 in ethanol for reflux reaction to form salicylyl hydrazine; performing reflux reaction of salicyloyl hydrazine and glyoxylic acid in a molar ratio of 1:1 in glacial acetic acid to obtain N-(2-acet)salicyloyl hydrazone; and heating diluted hydrochloric acid and N-(2-acet)salicyloyl hydrazone in a molar ratio of 1:2 in aqueous solution of ethanol for reflux reaction, and obtaining the N-(2-acet)salicyloyl hydrazone-rare earth complex. In the invention, the preparation method is simple, and the prepared rare earth complex has high bacteriostatic activity on valsa mali, puccinia striiformis f. sp. tritici and the like.

A wheat stripe rust germina molecule testing method, that is: the differential probe (the upsteam primers: 5'-TCTGTAAGATGTTAGATGC and the downsteam primers 5' -ATGCTGGCAGTGTGGTTG), expands by PCR (the expending parameter 94 centigrade pre-denaturalization 3min; then 94 centigrade denaturalization 50sec, 54 centigrade annealing 90sec 72 centigrade extends 2min, altogether 35 circulations; 72 centigrade extends 10min), the gelose gelatin electrophoresis, tests the disease-carrying situation of the wheat by the expanding production. The invention is used for forepart inspection of wheat stripe rust disease situation during winter and spring, provides the reliable technical support and the theory basis for the wheat stripe rust disease preventing and controlling decision-making.

The invention provides a puccinia striiformis f. sp. tritici uredospore automatic statistical counting method, which can be used for quantitative monitoring and accurate counting of puccinia striiformis f. sp. tritici uredospores in outdoor field air. The method comprises the following steps of collecting a microscopic image of the puccinia striiformis f. sp. tritici uredospores to a computer through a TPBZ3 spore capturer and a research-level microscope; and then performing a K-means clustering algorithm, morphological processing, shape factor and area-based adhered spore judgment, concavity-based adhered contour segmentation and adhered spore contour section fusion and counting, wherein the counting accuracy can reach 98.6%, and automatic statistics and counting of the uredospores are realized. The method is high in counting precision and high in practicality, solves the difficult problem, urgently needed to be solved, of counting of the puccinia striiformis f. sp. tritici uredospores in the outdoor field air, and provides technical support for online development of a puccinia striiformis f. sp. tritici uredospore monitoring device.

The invention relates to a method for measuring the growth cycle of puccinia striiformis by using a microcalorimetric method. The method comprises the following steps: under normal pressure and selected temperature, measuring the heat flow value of culture solution of puccinia striiformis in real time by using a C80 microcalorimetric instrument, storing the heat flow value in a computer, and then calculating to obtain a growth cycle curve of puccinia striiformis. The method has the advantages of being simple and convenient in operation as well as high in reliability. According to the measured growth cycle curve, the growth stages, the time length in the growth stages, the heat varying speed and the specific value in the growth cycle of puccinia striiformis can be clearly distinguished so as to provide useful reference for researching and preventing puccinia striiformis.

The invention discloses a quick molecular detection method of a novel mycelium T4 injecting wheat stripe rust with AABBDDXX. The method comprises the following steps: screening to obtain two specific RAPD (Random Amplified Polymorphic DNA) marks S1311 and S1363 of T4 by use of 189 RAPD random primers among the novel mycelium T4, epidemic strains of wheat stripe rust CYR29, CYR31, CYR32, CYR33 and Su11-4 and a novel mycelium V26 injecting an anti-stripe rust gene Yr26; recovering, purifying, cloning and sequencing the specific stripes, designing an SCAR (Sequence Characterized Amplified Regions) primer according to the sequencing result, and successfully converting the RAPD marks to stable SCAR marks T4SP8-1 / T4SP8-2 (the sequence is 5'GGGCGTGGATGAAGAG-3' / 5'-GGAGCAGAAGCAGGTTT3'); stably amplifying the specific stripe of the novel mycelium T4 at 700bp by the marks. The specific SCAR marks T4SP8-1 / T4SP8-2 of the novel mycelium T4 provided by the invention can be used for realizing quick molecular detection of the novel mycelium T4 in an early stage in a large field so as to understand the variation dynamic condition of the pathogenic bacteria, thereby providing a reliable technical support and a theoretical foundation for prophylaxis and treatment policy of the mycelium and the wheat stripe rust.

The invention relates to a detection and identification kit of a composite PCR of wheat stripe rust fungus and leaf rust fungus, which belongs to the technical fields of biotechnology, crop disease control and plant quarantine. The kit detects the specific genome DNA sequences of the wheat stripe rust fungus 171 bp and the leaf rust fungus 226 bp simultaneously in a primary PCR reaction by three primers from a fungal beta-tubulin gene conserved sequence and wheat stripe rust fungus and leaf rust fungus specific sequences. The invention provides supplement and improvement on the wheat stripe rust fungus and leaf rust fungus specific primer detecting method, and is suitable for the diagnostic detection of the stripe rust fungus and the leaf rust fungus in an infected wheat leaf before disease symptoms appear. Composite PCR technology is adopted in the kit, and in a PCR-SMART reaction solution, the three primers are amplified simultaneously, so the detection accuracy is increased, the detection time is saved, the operation is simple, and the kit can be applied and popularized at plant protection and plant quarantine departments in China.

The invention discloses a molecule detection method for puccinia striiformis f.sp.tritici No.17 physiological race. By employing a method for converting a RAPD molecular marker into a SCAR molecular marker, the specific primers (upstream primer 5' -TTCCCCCGCTGTCT and downstream primer 5'- GTTGAGCGGGGGAA) of No.17 physiological race are obtained, and are subjected to PCR amplified reaction (reaction conditions: 94 DEG C, 5 min, 1 cycle; 94 DEG C, 30 s, 60 DEG C, 1 min, 72 DEG C, 90 s, 35 cycles; 72 DEG C, 7 min, 1 cycle) and 2% agarose gel electrophoresis, so that an specific strip with a length of about 1000 bp is obtained. Therefore, the molecule detection method helps to rapidly discriminate and distinguish puccinia striiformis f.sp.tritici No.17 physiological race in molecular level, and establishes a base for developing research on wheat stripe rust molecular epidemiology.

The invention discloses a new wheat stripe rust resisting polygene-polymerized flower-nurture breeding method. Wheat-breeding parent materials with excellent agronomic characters are selected; 3 major micro-species of puccinia striiformis, which are recently popular, are used to evaluate stripe rust resistance of the wheat-breeding parent materials at seedling stage and adult stage; 3 wheat-breeding parent materials, which have high-resistance immunity to major popular individual micro-species of various puccinia striiformis, are sieved; the 3 wheat-breeding parent materials are hybridized and duplex hybridized to obtain duplex hybridized polygene-polymerized subsequent generation; the duplex hybridized subsequent generation is then cultured and wheat anther tissue is inoculated to one-step seeding culture medium of wheat anther, thereby obtaining complete pollen plant; chromosome doubling liquid with colchicines and dimethyl sulfoxide is injected to tillering node, thereby carrying out pollen plant chromosome doubling to obtain doubly purified individuals of doubled haploid which can be self-hybridized to form a stable doubled haploid system; and stripe rust resisting individual micro-species validation is carried out on the doubled haploid system, so as to obtain a new stripe rust resisting type or species system which is polymerized with 3 stripe rust resisting genes.

The invention belongs to the technical field of disease-resistant variety cultivation, and discloses an acquisition of edited wheat susceptible gene plants and application of edited wheat susceptiblegene plants in disease-resistant variety cultivation. The edited wheat susceptible gene plants have B, D and A copies in wheat. The RNAi mutants of the TaRIPK1 with two genetic backgrounds are obtained. According to the invention, an agrobacterium tumefaciens-mediated genetic transformation method is adopted, and a CRISPR-Cas9 gene editing technology is utilized to obtain the gene edited plant ofTaRIPK1. Through inoculation of wheat stripe rust bacteria, it is found that TaRIPK1 RNAi plant bacteria with two genetic backgrounds have remarkable resistance to stripe rust bacteria toxic race CYR32, disease resistance identification is conducted on a TaRIPK1 gene editing technology, and it is found through results that the disease resistance of TaRIPK1 gene editing plants is remarkably improved. The resistance to main epidemic races of puccinia striiformis and puccinia leaf rust is remarkable, and the plants can be used as a germplasm new material for genetic improvement of wheat rust resistance.

Compositions and methods for enhancing the resistance of wheat and barley plants to wheat stripe rust caused by Puccinia striiformis f. sp. tritici are provided. The compositions comprise nucleic acid molecules encoding resistance (R) gene products and variants thereof and plants, seeds, and plant cells comprising such nucleic acid molecules. The methods for enhancing the resistance of wheat and barley plants to wheat stripe rust comprise introducing a nucleic acid molecule encoding an R gene product into a wheat or barley plant cell. Additionally provided are methods for using the wheat and barley plants in agriculture to limit wheat stripe rust.

The invention discloses an IF2 translation initiation factor gene relevant to wheat yellow rust resistance. The overall length of a cDNA sequence of the gene is 1810bp, and a nucleotide sequence of the gene is shown as SEQ.ID.NO.1, wherein 1-165bp is a 5' non-translated region; 166-1386bp codes 406 kinds of amino acid, 1513-1665bp codes 50 kinds of amino acid, and 1666-1810bp is a 3' non-translated region. The gene is a conservative gene of wheat yellow rust resistance; RT-PCR expression analysis indicates that the gene has trace expressions under the normal condition, the induction expressionis increased after duress for 24 hours in a CY32 bacterial system, and the expression reaches the maximum for 72 hours and then is reduced in the following 4-7 days; disease resistant wheat leaves can display a symptom of suffering from puccinia striiformis infection by silencing the expression of the gene in yellow rust resistant wheat by an RNA interference technology.

The invention discloses a molecular detection method for rapid detection of new toxic strain V26 of puccnia striiformis West f.sp.tritici; by a large number of screening, a specific marker of the new toxic strain V26 of the puccnia striiformis West f.sp.tritici is obtained, the specific marker is sequenced, and according to sequencing results, a pair of specific primers comprising V26SP1:5'CTGTAAAGCGGATAAAGGAA 3', and V26SP2:5'CATAAGAGCCACACTTGACC3'. Optimal PCR (polymerase chain reaction) conditions of the pair of the specific primers are established. Different single spore strains of the V26 strain is detected by use of an optimal PCR method, and specific SCAR (sequence characterized amplified regions) markers of the V26 can be obtained by respectively taking of other 13 physiological races and ultra pure water as controls. The molecular detection method is mainly used for early-stage rapid detection of the V26 strain in a large field, the dynamic variation conditions can be known, and the molecular detection method provides reliable technical support and theoretical basis for monitoring of the strain and prevention and control decisions of wheat yellow stripe rust disease.

The invention provides a wheat gene Yr10 molecular marker and application thereof to screening of puccinia striiformis westend.f.sp.tritici-resistant wheat and belongs to the technical field of wheatbreeding. The wheat gene Yr10 molecular marker is characterized in that the Yr10 molecular marker has a nucleotide sequence shown as SEQ ID No.1 in a sequence table. The molecular marker is completelylinked with a puccinia striiformis westend.f.sp.tritici-resistant gene Yr10 and is named Xsdau79. Through detecting the molecular marker, whether the wheat gene Yr10 exists or not can be known, so that whether wheat varieties have the characteristics of puccinia striiformis westend.f.sp.tritici resistance or not can be determined. The molecular marker provided by the invention can accurately andquickly identify the puccinia striiformis westend.f.sp.tritici-resistant gene Yr10; therefore, the invention provides the application of a primer to the screening of the puccinia striiformis westend.f.sp.tritici-resistant wheat.

The invention relates to the detection of a fungal spore germination rate and particularly provides a method for determining a wheat stripe rust disease uredospore germination rate by utilizing a near-infrared spectroscopy. According to the method, on the basis of the near-infrared spectroscopy, a judgment model of the spore germination rate is established according to the germination rate of the wheat stripe rust disease uredospore and the near-infrared spectrum data of a corresponding sample, acquired by a spore germination test method, and the automatic nondestructive detection of the wheat stripe rust disease uredospore termination rate can be realized.

The invention relates to a wheat stripe rust teliospore germination technology system, which comprises the following steps: conducting low-temperature treatment on a wheat stripe rust teliospore material for one week or longer time, treating wheat tissues (leaves or sheathes) containing wheat stripe rust teliospore with sterile water, spraying water, soaking and placing in the low-temperature environment for 24 hours, then moving out and placing in a 16DEG C incubator and naturally drying for 24 hours; and repeating the above drying-wetting operation for 2-4 cycles, then soaking the wheat tissues containing wheat stripe rust teliospore for 24 hours with sterile water, placing the wheat stripe rust teliospore-containing tissue on a 2-4% water agar medium, placing in the 16DEG C incubator for culturing, and thus observing the germination of the wheat stripe rust teliospore. The wheat stripe rust teliospore germination technology system discloses that the wheat stripe rust in China has a perfect stage, and provides technological guarantee for disclosing the action of sexual propagation of the wheat stripe rust in China in the toxicity variation.

The invention relates to a Specificity SCAR marker for detecting puccinia striiform, and belongs to the technical fields of biology and plant quarantine. The length of the nucleotide sequence of the provided specificity SCAR marker is 180 bp. The SCAR marker has a high specificity on detecting puccinia striiform. The marker stably appears in the puccinia striiform standard samples from different wheat producing areas in China, and does not have polluting amplification on puccinia triticcina, puccinia graminis, or other wheat pathogenic fungi. So the SCAR marker can be applied to the diagnosis, detection, investigation, and prediction of wheat stripe rust disease.

The invention discloses a method for quickly and efficiently extracting deoxyribonucleic acid (DNA) of wheat stripe rust directly from infected wheat leaf blades. The method is characterized in that 20mu l of prepared 20% chelex-100 suspension is drawn and injected into a 100mu l polymerase chain reaction (PCR) tube; 5mu l of chelex-100 supernate is drawn and dripped on the wheat leaf blades with wheat stripe rust uredispore and the spots of the leaf blades on which the chelex-100 supernate is dripped are smeared repeatedly to wash off the aecidiospore; the chelex-100 supernate containing the aecidiospore on the leaf blades is drawn back and added into the PCR tube containing 20mu l of 20% chelex-100 suspension; the mixture is drawn repeatedly and mixed evenly by a liquid-moving device; the mixture is put in boiling water bath for water bath for 2 minutes and then put in a vortex mixer to be oscillated and mixed evenly for 10 seconds; the mixture is subjected to water bath for 5 minutes and preserved at the temperature of minus 20 DEG C for later use; and the supernate can be used as templates of PCR. The invention provides an efficient and rapid method for extracting DNA of wheat stripe rust which is used as PCR amplification templates directly from infected wheat leaf blades.

The invention provides application of a puccinia striiformis PSTG_06025 gene to wheat stripe rust prevention and treatment. The sequence of the PSTG_06025 gene is shown as Seq ID No.1. The PSTG_06025gene can be used for effectively regulating and controlling the growth and the breeding of the puccinia striiformis; the PSTG_06025 gene is used as a transcriptional control molecular target or a protein function inhibition gene target; the effect of inhibiting the growth and the breeding of the puccinia striiformis is achieved through silencing the PSTG_06025 gene. The wheat obtained by the method for culturing the anti-puccinia striiformis wheat by using the gene provided by invention has obvious puccinia striiformis resistance.

The invention belongs to the technical field of plant protection and provides a method for measuring the relative content of puccinia striiformis DNA (deoxyribose nucleic acid) in wheat leaves. The method comprises steps as follows: acquiring near-infrared spectrum information of to-be-tested leaves in the incubation period of wheat stripe rust; applying a measurement model to determine the relative content of puccinia striiformis DNA corresponding to the near-infrared spectrum information of the to-be-tested leaves in the incubation period of wheat stripe rust, wherein the measurement model indicates the corresponding relation between the near-infrared spectrum information and the relative content of puccinia striiformis DNA. The method for measuring the relative content of puccinia striiformis DNA in the wheat leaves can be used for measuring the relative content of puccinia striiformis DNA in the incubation period of wheat stripe rust quickly, accurately and quantitatively.

The invention provides a puccinia striiformis quantitative detection kit and application thereof. The kit comprises a normal reagent for fluorescent quantitation PCR amplification, and is characterized by further comprises a primer for detecting puccinia striiformis; the forward and reverse nucleotide sequences of the primer are as follows: osgQ607 / osg / Q608:GGATGCCTCGAAGGGTTATACC / TGCTAGATACAATGGCACATCTGA. The invention further discloses a method for quantitatively detecting the number of puccinia striiformis copies in wheat by utilizing the kit. Through adoption of the kit and the method, the infection amount of puccinia striiformis in a gleying state can be measured relatively accurately and quantitatively, the characteristics such as a low detection limit as well as high sensitivity, specificity and amplification efficiency are achieved, and a reliable detection means is provided for early prediction and control of wheat stripe rust.

The invention discloses a visual detection kit for wheat pathogenic fungi, and belongs to the field of molecular detection. The kit comprises a sample pretreatment part, a probe identification part, a detection result visualization part and a data management part; a heating extraction method is adopted for the sample pretreatment part, and the time is within 5 min; DNA double strands embedded with silver ions are adopted as a detection probe; The visual result is composed of a test paper reaction tank, a smart phone signal acquisition and a monitoring data management cloud webpage. The detection principle is based on replacement of mismatched chains by pathogenic bacteria RNA, release of silver ions, inactivation of urease and prevention of urea decomposition, and the paper-based chip is yellow under the action of phenol red , otherwise the color is red. The kit can be used for simultaneously screening a plurality of common wheat pathogenic bacteria diseases including stripe rust, root rot, fusarium graminearum and the like. The amount of RNA of puccinia striiformis can be calculated through an image management webpage according to a test result, the number of viable bacteria of pathogenic bacteria is estimated, the wheat disease infection condition is accurately judged, and the accuracy, stability and convenience of wheat disease detection are further improved.

The invention discloses 'a monoclonal antibody, an immune fluorescence method and a kit for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici' and belongs to the field of agricultural biotechnology. The invention mainly provides the monoclonal antibody for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici, which is secreted by hybridoma cell line with a collection number CGMCC No.4414 and can identify puccinia triticina f.sp.tritici, puccicinia graminis f.sp.tritici and puccinia striiformis f.sp.tritici at the same time. The invention also provides a detection method based on the combination of the monoclonal antibody and an immune fluorescence technology and a kit. The monoclonal antibody, the detection method and the kit have the advantages of high specificity, high sensitivity, and simplicity and quickness of operation.

The invention belongs to the field of gene engineering, and discloses a small GTP binding protein gene TaRab18 and an expression vector and application thereof. The cDNA sequence of the small GTP binding protein gene TaRab18 is SEQ ID NO.1, and the sequence amino acid coded by the small GTP binding protein gene TaRab18 is SEQ IDNO.2. The gene comes from ordinary wheat (Triticum asetivum L.)92R137. The puccinia striiformis induction expression of TaRab18 in the stripe rust prevention wheat variety 92R137 is enhanced, the expression level of TaRab18 is far higher than the expression level in susceptible wheat variety Yangmai 158. An over-expression vector is obtained by inserting the gene in pBI220, susceptible wheat variety Yangmai 158 is converted, the result of substituting T1 of positive transformation plants to the stripe rust identification shows that the resistance of the susceptible wheat variety to the stripe rust can be improved through the over-expression of TaRab18.

The invention belongs to the technical field of crop variety breeding, and discloses a transcription factor for improving rust disease resistant wheat varieties and a screening and obtaining method ofthe transcription factor. The transcription factor is TaWRKY19 and BdWRKY67 of a WRKY transcription factor in brachypodium distachyon, wherein the ORF coding sequence of the TaWRKY19 is SEQID NO:1, and the ORF coding sequence of the BdWRKY67 of the WRKY transcription factor gene in the brachypodium distachyon is SEQID NO: 2. An RNAi mutant of the WRKY transcription factor is obtained through agrobacterium tumefaciens mediated heredity and transformation, brachypodium sylvaticum is inoculated for disease resistance identification, and through the result, the inventor finds that the RNAi plantdisease resistance of the BdWRKY67 is notably improved. The disease resistance of plant wheat obtained through silencing of the TaWRKY19 transcription factor is notably improved, and the resistance ofplants subjected to instantaneous overexpression to puccinia striiformis is also obviously diminished, so that the transcription factor can be used for heredity improvement of stripe rust resistant wheat.

The invention relates to the technical field of crop planting, in particular to a resistance evaluation method for stripe rust of wheat and a method for controlling the stripe rust of the wheat by utilizing variety diversity. Puccinia striiformis is manually inoculated to to-be-detected wheat, wheat leaf DNA in the incubation period is extracted, puccinia striiformis DNA and wheat DNA are separately quantified, and the resistance level of the stripe rust of the to-be-detected wheat is judged according to the content ratio of the puccinia striiformis DNA in the wheat leaf DNA to the wheat DNA.Different resistance varieties are selected for mixed variety sowing according to indexes of the resistance level of the stripe rust of wheat varieties and the like, the wheat variety diversity planting mode is formed, the stripe rust states of the wheat and diseases are significantly reduced, and the stripe rust of the wheat can be efficiently controlled; the yield of wheat is effectively increased, service life periods of varieties are prolonged, the method is more beneficial for the stable population genetic structure of the puccinia striiformis, and important significance on ecological prevention and control for the stripe rust of the wheat is achieved.

The invention relates to a method for determining virulence of bactericide to wheat stripe rust and belongs to the physical protection field. An inhibition condition of triadimefon to the virulence ofthe wheat stripe rust is determined through adopting steps of spraying inoculation of a stripe rust uredospore suspension liquid, fresh-keeping culture medium preparing, in-vitro leaf segment medicament treating, detection and the like. In the invention, an in-vitro leaf segment mode is adopted to replace a whole plant to carry out testing, which is beneficial to solving problems of a large amount of test samples and large influence factors in a test process. Effects of different preservatives and a fresh-keeping substrate on spore germination, and the effects of medicine spraying, dipping and containing modes on an inhibition rate of the stripe rust after bactericide treatment is performed on the in-vitro leaf segment are also determined so as to determine an optimal scheme. The method has high repeatability and potential socioeconomic significance.

The invention provides a wheat gene Yr10 molecular marker and application thereof to screening of puccinia striiformis westend.f.sp.tritici-resistant wheat and belongs to the technical field of wheatbreeding. The wheat gene Yr10 molecular marker is characterized in that the Yr10 molecular marker has a nucleotide sequence shown as SEQ ID No.1 in a sequence table. The molecular marker is completelylinked with a puccinia striiformis westend.f.sp.tritici-resistant gene Yr10 and is named Xsdau79. Through detecting the molecular marker, whether the wheat gene Yr10 exists or not can be known, so that whether wheat varieties have the characteristics of puccinia striiformis westend.f.sp.tritici resistance or not can be determined. The molecular marker provided by the invention can accurately andquickly identify the puccinia striiformis westend.f.sp.tritici-resistant gene Yr10; therefore, the invention provides the application of a primer to the screening of the puccinia striiformis westend.f.sp.tritici-resistant wheat.

The invention discloses 'a monoclonal antibody, an immune fluorescence method and a kit for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici' and belongs to the field of agricultural biotechnology. The invention mainly provides the monoclonal antibody for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici, which is secreted by hybridoma cell line with a collection number CGMCC No.4414 and can identify puccinia triticina f.sp.tritici, puccicinia graminis f.sp.tritici and puccinia striiformis f.sp.tritici at the same time. The invention also provides a detection method based on the combination of the monoclonal antibody and an immune fluorescence technology and a kit. The monoclonal antibody, the detection method and the kit have the advantages of high specificity, high sensitivity, and simplicity and quickness of operation.